Table 2

Unique sequences of miRNA isoforms (isomiRs) and other sncRNAs (with RPM ≥100) that underwent significant (qFDR < 0.05) differential up- or down-regulation following SNL nerve injury in HA vs. LA rats
Small RNA type and sequence Mean RPM Mean RPM SNL-reg diff-reg
(canonical miRNA or RNA type) (sham pools) (SNL pools) subtraction method (SNL/sham fold-change)
HA LA HA LA HA LA HA-LA
unique-sequence miRNA isoform (isomiR), all pools, and those added by HA_SNL1 pool exclusion *
UAUAGUACUGUGAUAACUGACU (rno-miR-101a-3p) 11.7 9.3 9.9 11.3 −0.167 (−1.182) 0.194 (1.215) −0.361 (0.397)
CAGUGCAAUGUUAAAAGGGC (rno-miR-130a-3p) * 38.0 41.9 48.2 45.0 0.237 (1.268) 0.071 (1.074) 0.166 (0.194)
UCCCUGAGACCCUAACUUG (rno-miR-125b-5p) * 47.8 30.4 35.5 33.1 −0.295 (−1.346) 0.085 (1.089) −0.380 (0.435)
UGGACGGUGUGAGGCC (sha-miR- 5105) * 11.0 15.6 13.5 11.9 0.204 (1.227) −0.269 (−1.311) 0.473 (0.537)
unique-sequence sncRNAs with RPM ≥100, after HA_SNL1 pool exclusion
AGCCGCCUGGAUACCGCAGCUAGGAAUAA (rRNA) 1843.3 616.5 548.0 666.0 −1.846 (−3.363) 0.078 (1.080) −1.924 (2.443)
GCAUUAGUGGUUCAGUGG (tRNA) 621.1 719.9 771.1 713.5 0.215 (1.242) −0.009 (−1.009) 0.224 (0.251)
UCAUUGGUGGUUCAGUGG (tRNA) 88.6 111.5 114.1 103.4 0.252 (1.288) −0.075 (−1.078) 0.327 (0.366)

Bali et al.

Bali et al. Molecular Pain 2014 10:22   doi:10.1186/1744-8069-10-22

Open Data