Table 1

RT-PCR primer pairs and PCR product sizes
Gene Primer pairs Product (bp)
NPY CCGCCCGCCATGATGCTAGG 150
GGCCATGTCCTCTGCTGGCG
GAL CCTCGTGCGCTTCCCTACGC 148
GCCCCTGGCCATCTTGAGCA
ATF3 GGACGACCGACCAACCCGC 122
CATTTTGCTCCAGTCTTCGCTCGGG
VIP GGACCAGGGGCAGACTCCGT 121
TCCATCTCGGTGCCTCCTTGGG
MCP-1 GAGGCCAGCCCAGAAACCAGC 153
TGGGGCATTAACTGCATCTGGC
GAPDH GGGGCTCTCTGCTCCTCCCTG 108
ACGGCCAAATCCGTTCACACC

Lebovitz et al.

Lebovitz et al. Molecular Pain 2012 8:70   doi:10.1186/1744-8069-8-70

Open Data